DNA & Polypeptide Synthesis Short Answer Quiz 1

Construct a flow chart in the space below to outline the process by which DNA controls the production of polypeptides. (5 marks)

The table shows a list of amino acids and the base sequences on a messenger RNA strand the code for them during protein synthesis.

A section of DNA contained the base sequence: ATATCCAAACGC
For the DNA section given, describe the steps by which this code could be used by ribosomes to make a polypeptide. (5 marks)

The following diagrams show the formation of an enzyme within a cell.

(a) Identify the structures represented by each of the following letters

D: ………………………………………………
F: ……………………………………………….
G: ………………………………………………

H: ………………………………………………

I: ……………………………………………….

J: ……………………………………………….

(b) Identify and describe the processes occurring at –

B: ……………………………………….

K/M: …………………………………………..

Below is an mRNA sequence as it appears in the ribsome ready for translation and the universal code for translating this base sequence into an amino acid sequence.

(a) Using the universal code above, it can be seen that AUG is the start codon for this particular gene. What will be the amino acid sequence produced by the remainder of this particular base sequence?

Below is a DNA sequence for a particular gene which codes for insulin. Only the active side of the DNA sequence is shown. In your answers show all your working.

TACCGGACGTCGATGCGCTAG

The Genetic Code (mRNA)

(a) Using the table of mRNA codons above, write down the amino acid sequence for the DNA strand above. (2 marks)
Answer:

Consider the following DNA sequence: TAC CAT TAG GGC TGG

In your answer booklet give the complementary sequences of the nucleic acids that would result from the following processes
(i) Transcription
(ii) Translation

Using the genetic code provided on the next page;

(a) state a DNA base sequence that would code for the polypeptide segment: – tyrosine – cysteine – tryptophan – (Read left to right; state your answer left to right.) (1 mark)

(b) State the mRNA base sequence that would be synthesised from the DNA base sequence you gave in (a). (Read left to right; state your answer left to right.) (1 mark)

(c) Name the organelle the mRNA segment attaches to in the cytoplasm. (1 mark)
(d) State the tRNA anticodons for the mRNA codons you gave in (b). (Read left to right; state your answer left to right.) (1 mark)
(e) Describe the role of tRNA in forming the polypeptide segment. (1 mark)

There are some significant differences in the form that DNA has in prokaryotic and eukaryotic cells.
In the space provided draw a labelled diagram demonstrating the difference in the form of DNA between prokaryotic and eukaryotic cells. (3 marks)

Immunoglobulin molecules are a protein that display a tertiary structure and a quaternary structure. Explain what ‘quaternary’ means.

The diagrams below represent examples of three levels of structure with respect to the folding and assembly of a protein. The diagrams are not to scale.

i. Complete the table below to indicate the diagram that represents the structural level of the protein given. (1 mark)

ii. Name the molecular sub-unit of a protein. ( 1mark)

Scientists studying the nucleus of the fruit fly Drosophila melanogaster observed distinct types of nucleic acid chains. These scientists noticed that one type of nucleic acid chain was able to pass through the nuclear membrane and move to a ribosome. After the nucleic acid chain attaches to the ribosome, a polymer is produced.

(a) Describe the steps occurring at the ribosome that resulted in the production of the polymer. (3 marks)
(b) One particular length of nucleic acid chain passed through the nuclear membrane and coded for the production of a polymer that was 90 monomers long. How many nucleotide bases on the nucleic acid chain were involved in the coding for this polymer? Explain your response. (2 marks)

Describe what is meant by tertiary and quaternary protein structures. (2 marks)

The following diagram outlines various events that occur in cells when DNA is activated.

(a). i. Outline events that occur during action X. (2 marks)
(a) ii. Note that structure P consists of two different kinds of components.
What are these two components called and what happens to each component? (2 marks)
(b) Describe the events occurring in stage 2, including the role of each of the structures S, F, E and G. (4 marks)